rs10438062 chr14:35336946 C>T
- Sequence
gtgaggaagggtggaggaggggtt[C/T]gaggcctcaaccatcccttggccc
- ASB in cell types
- A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma) MDA-MB-453 (breast adenocarcinoma) cranial neural crest cells
- ASB for transcription factors
- RAD21_HUMAN JUN_HUMAN EP300_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.22 | 1.17 | 1.92 | n/a | n/a | |||
| JUN_HUMAN | -0.42 | 1.32 | 2.06 | n/a | No Hit | |||
| EP300_HUMAN | -0.32 | 1.22 | 1.51 | n/a | n/a | |||
| ANDR_HUMAN | 0.13 | 2.92 | 1.75 | n/a | No Hit | |||
| SMC3_HUMAN | -0.03 | 0.99 | 2.10 | n/a | n/a |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, college completion, height, ldl cholesterol change with statins, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood