rs10445937 chr2:60410521 G>A
- Sequence
ccccgaaactcagaagccataatc[G/A]ctgctctctgaagccatttcaaat
- ASB in cell types
- cranial neural crest cells
- ASB for transcription factors
- COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | n/a | 2.11 | 2.00 | -0.69 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adult fetal hemoblogbin levels (hbf) by f cell levels, bipolar disorder, combined control dataset, gender differentiated, body mass index (bmi), college completion, fasting blood glucose, fetal hemoglobin (hbf), ldl cholesterol, mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), red blood cell count (rbc), total cholesterol, years of education