rs1044867 chr16:70162064 T>G
- Sequence
gaatgtcagatggtgggtgcagat[T/G]ggaagaaagagaaaagttcatctc
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- FOS_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOS_HUMAN | 2.07 | -2.41 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1