rs10470707 chr3:64692061 G>A
- Sequence
tttggcctgatgaataccatctgt[G/A]agaacatcattttttcttctaatg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -1.58 | 1.07 | 5.93 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, comorbid depressive syndrome and alcohol dependence, irritible bowel syndrome, mitral annular calcium, resistance to kuru in aged women despite likely exposure, tetrology of fallot, total cholesterol, triglycerides change with statins