rs10481048 chr8:37612592 G>T
- Sequence
agagcaggtgtttcaggaggtggg[G/T]gggtagtaaaactccttaggctga
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.06 | 0.97 | 1.83 | |||
| HEK293T (embryonic kidney) | -0.35 | 1.02 | 1.94 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, serum creatinine