rs1048343 chr17:46196523 C>T
- Sequence
tgctacagtcacctttgcagcaag[C/T]ctgaagatgccaccaacatcaaag
- ASB in cell types
- Th1-cells
- ASB for transcription factors
- TBX21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBX21_HUMAN | 1.64 | n/a | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), diastolic blood pressure (dbp), height, ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1), obesity (body mass index (bmi)), systolic blood pressure (sbp), triglycerides, waist hip ratio