rs10484876 chr6:52389351 C>T
- Sequence
attctggggacatctttcctctga[C/T]tgtttgctgatagaaataaagcat
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.05 | 0.76 | 2.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, premature ovarian failure, primary rhegmatogenous retinal detachment, schizophrenia, sporadic creutzfeldt-jakob disease, total cholesterol
GTEx eQTL Brain_Cortex, Cells_Cultured_fibroblasts, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis