rs10486567 chr7:27936944 G>A
- Sequence
catgcttgctgactctaagtttaa[G/A]tatcccattacacagcaagttaaa
- ASB in cell types
- VCaP (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -0.36 | 0.94 | 1.79 | 3.63 | Concordant | |||
| FOXA1_HUMAN | 0.34 | 1.07 | 1.85 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP college completion, maternal transmission distortion, prostate cancer, prostate cancer (non-advanced prostate cancer), prostate cancer aggressiveness, resistance to kuru in aged women despite likely exposure
PheWAS abnormal tumor markers, elevated cea or ca 125, absent or infrequent menstruation, acute cystitis, adrenal hypofunction, alopecia, ankylosing spondylitis, aphakia and other disorders of lens, bladder cancer, cancer of kidney and urinary organs, cancer of the lower gi tract, cardiac defibrillator in situ, cellulitis and abscess of leg, central/nonobstroctive sleep apnea, cerebral aneurysm, colon cancer, colorectal cancer, congenital anomalies of face and neck, congenital musculoskeletal deformities of spine, cystic kidney disease, delirium dementia and amnestic disorders, dementias, disorders of coccyx, fracture of ribs, generalized anxiety disorder, genital prolapse, gram negative septicemia, hepatic cancer, primary, herpes zoster, hypersomnia, inflammatory disease of cervix, vagina, and vulva, inflammatory diseases of female pelvic organs, liver replaced by transplant, mental disorders due to brain damage, nephritis & nephropathy, neurological disorders due to brain damage, non-melanoma skin cancer, nonrheumatic pulmonary valve disorders, nonsenile cataract, nonspecific findings on examination of blood, nontoxic uninodular goiter, open wound of eye or eyelid, other disorders of urethra and urinary tract, other specified intestinal malabsorption, other specified nonpsychotic and/or transient mental disorders, peritonitis and retroperitoneal infections, phlebitis and thrombophlebitis, precordial pain, prolapse of vaginal walls, pruritus and related conditions, respiratory failure, sialoadenitis, stomatitis and mucositis, streptococcus infection, stress incontinence, female, ulcerative stomatitis & mucositis, urethritis and urethral syndrome, vascular dementia, viral warts & hpv