rs10488016 chr7:36742903 C>T
- Sequence
tttattatcatcatgatacaagct[C/T]ttccccttgagcaaggtcattgga
- ASB in cell types
- periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | 1.74 | -1.22 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), triglycerides change with statins