rs10496444 chr2:112796091 A>G
- Sequence
gaacacagggacggtttctcagac[A/G]ttgctatgtgttagcttgaagagt
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
- ASB for transcription factors
- SPI1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.49 | 0.72 | 1.96 | n/a | No Hit | |||
| CTCF_HUMAN | 1.10 | -0.42 | 2.07 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, amyotrophic lateral sclerosis (als), endometriosis, fasting blood glucose, obesity with early age of onset (age >2), serum creatinine
GTEx eQTL Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid