rs10502372 chr18:8480757 C>T
- Sequence
ctcagtctatcagcacctaaaatg[C/T]ggcttgggacaagtccttgtttgt
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.03 | 0.10 | 1.19 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, hdl cholesterol, hypertension (early onset hypertension), infant head circumference, paternal transmission distortion, resistance to kuru in aged women despite likely exposure, total cholesterol change with statins, transmission distortion, triglycerides change with statins