rs10737424 chr1:226627060 G>A
- Sequence
ttcatgtgtatttggagatagggc[G/A]tgtgaggagatggtaagggttgaa
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.44 | 0.88 | 3.51 | |||
| HEK293T (embryonic kidney) | -0.48 | 1.13 | 2.04 |
Items per page:
1 – 2 of 2