rs10741659 chr11:1349090 T>C
- Sequence
cgcccacccggagctccccgggga[T/C]ggcctctgcgtgcggcctcatgac
- ASB in cell types
- cranial neural crest cells
- ASB for transcription factors
- COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | n/a | 2.90 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Thyroid