rs10744179 chr12:124829354 C>A
- Sequence
gttttcctgcctctgctcttgccc[C/A]ccgccccgttctccccacagaatc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.91 | -0.12 | 2.04 | |||
| GM12878 (female B-cells) | -0.24 | 0.90 | 1.33 |
Items per page:
1 – 2 of 2