rs10748700 chr10:97553681 G>C
- Sequence
ccaacaccagcccagaggtgctgc[G/C]gctgccctctgctggctctgaggt
- ASB in cell types
- neural cell LNCaP C4-2B (prostate carcinoma) thyroid gland OCI-LY7 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- CTCF_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.70 | 0.96 | 1.48 | 0.29 | Weak Discordant | |||
| SMC3_HUMAN | 0.78 | 0.43 | 1.17 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood