rs10760614 chr9:129384126 C>T
- Sequence
tgcagctacttcttctgacttgga[C/T]tgggggtagggtagggtagggggc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.78 | 0.13 | 1.74 | |||
| HCT-116 (colon carcinoma) | -1.06 | 1.24 | 1.17 |
Items per page:
1 – 2 of 2