rs1076605 chr21:15553341 G>A
- Sequence
tgagtctctgtttttcagtaacca[G/A]agagaacatggagagagagctctt
- ASB in cell types
- foreskin keratinocyte neural cell PC9 (lung adenocarcinoma) LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.64 | 2.83 | |||
| neural cell | -0.29 | 0.74 | 1.00 | |||
| PC9 (lung adenocarcinoma) | 2.18 | -2.82 | 2.00 | |||
| LNCaP C4-2B (prostate carcinoma) | n/a | 2.14 | 2.00 |
Items per page:
1 – 4 of 4