rs10774116 chr12:3110661 C>A
- Sequence
taggaggtcctcagtccttgctgg[C/A]tgaatgagtgaacacatgaatgaa
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- FOXA2_HUMAN ZNF24_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | n/a | 2.26 | 1.33 | n/a | No Hit | |||
| ZNF24_HUMAN | -1.59 | 1.95 | 1.17 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), fasting blood glucose, fasting insulin, homa-ir, ldl cholesterol change with statins, systolic blood pressure (sbp)