rs10774774 chr12:109573424 G>T
- Sequence
gagcctggcggcgccgaagcaccc[G/T]cgcaggccaagacggctccccagg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) LNCaP C4-2B (prostate carcinoma) GM12878 (female B-cells) HepG2 (hepatoblastoma)
- ASB for transcription factors
- CREB1_HUMAN ZFX_HUMAN CXXC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 0.48 | 1.32 | 1.54 | n/a | No Hit | |||
| ZFX_HUMAN | 1.80 | 1.81 | 2.07 | n/a | No Hit | |||
| CXXC1_HUMAN | 1.66 | -1.72 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Testis, Thyroid, Whole_Blood