rs1077540 chr15:80805752 C>T
- Sequence
ctaacatgaatcaaatttaaattg[C/T]ttacataaacttgatatgccaaat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.54 | 1.29 | 1.67 | 6.04 | Concordant | |||
| FOXA2_HUMAN | n/a | 1.59 | 1.33 | 5.52 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, bipolar disorder, parkinsons disease, refractive error, years of education