rs10794315 chr11:350580 C>T
- Sequence
taaccgattagatcagccagcggt[C/T]gatctttaactaccaggcccaggg
- ASB in cell types
- CD34+ bone marrow cell-derived erythroid progenitors CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- ENL_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ENL_HUMAN | 2.41 | -2.65 | 1.33 | n/a | n/a | |||
| GATA1_HUMAN | 1.74 | -0.97 | 1.83 | n/a | No Hit |
Items per page:
1 – 2 of 2