rs10795068 chr10:3740227 A>G
- Sequence
tacccactcatatggtatgagagg[A/G]accccagcagagcaggaagttcag
- ASB in cell types
- HT29 (colon adenocarcinoma) K562 (myelogenous leukemia) SK-N-SH (neuroblastoma)
- ASB for transcription factors
- PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PPARG_HUMAN | 1.99 | -0.64 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, aortic valve calcium, hypertension (early onset hypertension), irritible bowel syndrome, paternal transmission distortion, spine bone mineral density (bmd), transmission distortion