rs10811140 chr9:19230401 T>C
- Sequence
cccctcctccctgcgtcttctccc[T/C]cccaccccccgcccttttccaccc
- ASB in cell types
- GM12878 (female B-cells) HEK293T (embryonic kidney)
- ASB for transcription factors
- IKZF1_HUMAN PRDM9_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 1.96 | -0.99 | 1.33 | -2.08 | Concordant | |||
| PRDM9_HUMAN | 2.35 | -1.41 | 2.00 | n/a | n/a | |||
| IKZF2_HUMAN | 1.87 | -1.46 | 1.33 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood