rs10828725 chr10:24929314 G>T
- Sequence
gtttctcttccctcaagggagcag[G/T]tttgtggctaacccttagctctaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- BHE40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BHE40_HUMAN | -1.35 | 1.71 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI high light scatter reticulocyte count, high light scatter reticulocyte percentage of red cells, immature fraction of reticulocytes, white blood cell count
GRASP body mass index (bmi), ldl cholesterol change with statins, neuroblastoma (brain cancer), obesity (body mass index (bmi)), rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Testis, Thyroid