rs10838591 chr11:46252592 A>G
- Sequence
acatctctcctgccacatcagagt[A/G]aagactggatcctgagctggggct
- ASB in cell types
- K562 (myelogenous leukemia) liver
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.25 | 0.81 | 1.99 | |||
| liver | 0.96 | -0.17 | 1.33 |
Items per page:
1 – 2 of 2