rs10840613 chr12:121711265 G>T
- Sequence
ccaccacacctggctaattttttt[G/T]tgtgtttttagtagagatggggtt
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.64 | -0.20 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Liver, Muscle_Skeletal, Nerve_Tibial, Spleen, Testis, Whole_Blood