rs10845940 chr12:7807313 G>T
- Sequence
aaaaatggattgaaaaccttagca[G/T]aataagtgacactgcttttacaag
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.44 | -0.32 | 2.01 | |||
| foreskin keratinocyte | 1.09 | -3.10 | 2.33 |
Items per page:
1 – 2 of 2