rs10846366 chr12:8026290 T>G
- Sequence
ttttcctttcctccgtgtcattca[T/G]tctcttatgtaacgtaaacaaatg
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.31 | 0.85 | 2.02 | |||
| GM12878 (female B-cells) | 0.47 | 0.69 | 1.31 | |||
| HEK293T (embryonic kidney) | 1.07 | -0.36 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Testis