rs10857810 chr1:110059175 C>G
- Sequence
ctggtgggggactcaccccctcct[C/G]tcgaatcagctcagccctgatgtg
- ASB in cell types
- K562 (myelogenous leukemia) cranial neural crest cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.26 | 0.74 | 1.34 | |||
| cranial neural crest cells | 1.63 | -1.34 | 2.00 |
Items per page:
1 – 2 of 2