rs10858908 chr12:89540880 A>T
- Sequence
gagggcagagagaaaagaccagac[A/T]gctcttggaacagactgttcttcc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- CTBP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTBP1_HUMAN | n/a | 2.33 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, coronary artery disease (cad), height, ldl cholesterol, refractive error, total cholesterol, transmission distortion
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Spleen