rs10862313 chr12:81451422 C>A
- Sequence
ttagcctgacggggcagagaggaa[C/A]catgctgggaaggggtagtggcag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.10 | 0.65 | 1.68 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Lung, Muscle_Skeletal, Thyroid