rs10864625 chr1:6554170 G>A
- Sequence
cacgggccgcaccggtgggatgag[G/A]agaggccggtggcaactcgaggcg
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
- ASB for transcription factors
- RHG35_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RHG35_HUMAN | 2.10 | n/a | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), fasting insulin, homa-ir, hypertension (early onset hypertension), infant head circumference, ldl cholesterol, ldl cholesterol change with statins, prop taste detection threshold, refractive error, total cholesterol, total cholesterol change with statins, variant creutzfeldt-jakob disease, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood