rs10864691 chr1:230104703 T>A
- Sequence
tcaaaatgtaaatgacatttgcag[T/A]gctgggaggtaggagggcgatccc
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.44 | -0.50 | 3.70 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.60 | -0.05 | 1.71 |
Items per page:
1 – 2 of 2