rs10865802 chr3:25023407 C>G
- Sequence
cttttttatttactgaggttaaga[C/G]gaatgttggctttgtcctttattg
- ASB in cell types
- VCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.41 | 0.98 | 1.57 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, hdl cholesterol, homa-ir, schizophrenia, type 2 diabetes, hypertension, coronary artery disease (cad), combined case analysis, gender differentiated