rs10883927 chr10:103850047 G>T
- Sequence
gaggcaattagaaggcaatttaca[G/T]ggaactgctgtgcaaacccaaagt
- ASB in cell types
- periferal blood macrophages monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.08 | -1.10 | 2.12 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg