rs1088870 chr7:44733852 T>G
- Sequence
ttagtagtgacggagttttgccat[T/G]ttagccaggctggtctcaaactcc
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.70 | 0.06 | 1.51 | |||
| K562 (myelogenous leukemia) | 0.88 | -0.31 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Thyroid, Whole_Blood