rs10892819 chr11:122203336 T>G
- Sequence
cagtcctcagtgcctggaggtctc[T/G]gggtccaggtgagtgtggtgtgag
- ASB in cell types
- foreskin keratinocyte sigmoid colon LNCaP (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.14 | 0.50 | 1.36 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP eye color, hdl cholesterol, pathological myopia, rheumatoid arthritis, triglycerides change with statins, waist hip ratio