rs10908826 chr1:161202735 C>T
- Sequence
cttcagtaatttgaatgcacctct[C/T]ctgtcatacctgagtagagctcag
- ASB in cell types
- HEK293 (embryonic kidney) H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.24 | 0.87 | 2.02 | |||
| H929 (plasma cell myeloma) | -2.21 | 1.84 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, diastolic blood pressure (dbp), hdl cholesterol, lymphocyte count, primary rhegmatogenous retinal detachment, schizophrenia, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Brain_Spinal_cord_cervical_c-1, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood