rs10911042 chr1:182236280 T>C
- Sequence
ggctatgaatgggcctaatgagaa[T/C]tgattgattcgctcgagatgtttt
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
- ASB for transcription factors
- ATF3_HUMAN MEIS2_HUMAN REQU_HUMAN ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF3_HUMAN | 1.92 | n/a | 3.00 | n/a | No Hit | |||
| MEIS2_HUMAN | 1.76 | n/a | 2.50 | n/a | No Hit | |||
| REQU_HUMAN | 2.44 | n/a | 2.75 | n/a | n/a | |||
| ARI1B_HUMAN | 0.64 | n/a | 3.00 | n/a | n/a | |||
| EGR1_HUMAN | 2.35 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 5 of 14
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), coronary artery disease (cad), fasting blood glucose, hdl cholesterol, transmission distortion, years of education