rs10914420 chr1:31511749 G>A
- Sequence
aaacactcagaatataagaagcac[G/A]gattatgggtacgatacttagggg
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.62 | 0.35 | 1.34 | |||
| GM12878 (female B-cells) | 0.11 | 0.71 | 1.31 | |||
| HepG2 (hepatoblastoma) | 0.61 | 0.05 | 1.38 |
Items per page:
1 – 3 of 3