rs10915715 chr1:223749162 G>A
- Sequence
gatgtgcaggggtcctgctgtcct[G/A]acacgatggccacaggcacagttt
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- SMC3_HUMAN CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | -0.38 | 1.07 | 2.05 | n/a | n/a | |||
| CTCF_HUMAN | 0.33 | 0.83 | 1.56 | n/a | No Hit | |||
| RAD21_HUMAN | -0.31 | 0.87 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Testis