rs10915917 chr1:223870571 T>G
- Sequence
tgtatgaggcgtctgttgacccct[T/G]ttgggaggtttaatgtgtagcttc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- HTF4_HUMAN KDM1A_HUMAN NCOR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HTF4_HUMAN | -3.44 | 2.49 | 2.50 | n/a | No Hit | |||
| KDM1A_HUMAN | -3.37 | 1.88 | 2.50 | n/a | n/a | |||
| NCOR1_HUMAN | -3.27 | 1.98 | 2.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood