rs10916261 chr1:228043648 A>G
- Sequence
gccagaactccagagcctggacgt[A/G]agtcctggcctcaggggagccctg
- ASB in cell types
- MDA-MB-453 (breast adenocarcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.37 | 0.48 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cortex, Cells_Cultured_fibroblasts, Skin_Not_Sun_Exposed_Suprapubic