rs10920285 chr1:201968286 C>T
- Sequence
aagtgctgggaatgtgagccatcg[C/T]gcccagcaaaaaagtttttaaaac
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.55 | -0.31 | 2.03 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), hip bone mineral density (bmd), longstanding arthritis, mitral annular calcium, neuroblastoma (brain cancer)
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Muscle_Skeletal, Spleen, Stomach, Whole_Blood