rs10922177 chr1:197184637 T>C
- Sequence
tattaatatagtttaaaactacat[T/C]tgttttgtaaatcatatcacatta
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN426_HUMAN ZNF34_HUMAN ZN555_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN426_HUMAN | n/a | 2.84 | 2.00 | n/a | n/a | |||
| ZNF34_HUMAN | n/a | 2.86 | 2.00 | n/a | n/a | |||
| ZN555_HUMAN | -2.39 | 2.47 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), factor xiii a subunit, factor xiii activity, factor xiii b subunit, hdl cholesterol