rs10924745 chr1:246493001 A>G
- Sequence
ggtacattgtttcttttgtgggtg[A/G]taagaattttctaaagttgattat
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.47 | 0.98 | 2.62 | |||
| foreskin keratinocyte | 1.71 | -2.32 | 2.17 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Minor_Salivary_Gland, Testis