rs10929322 chr2:233241056 C>T
- Sequence
tagcaagaatcaaagtgcttattg[C/T]cttttagatacttccccagtaccc
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | -1.53 | 1.32 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, homa-b, ldl cholesterol change with statins, total cholesterol change with statins, triglycerides change with statins, years of education
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Liver, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood