rs10931915 chr2:200736916 T>C
- Sequence
ataaggataacaaggagcagctca[T/C]ggttcccttatcaactaaattagc
- ASB in cell types
- HUES64 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUES64 (embryonic stem cells) | 0.14 | 0.86 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), rheumatoid arthritis, systolic blood pressure (sbp), triglycerides, urinary albumin-to-creatinine ratio
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Lung, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Testis