rs10941607 chr5:43058254 C>G
- Sequence
cttctgccttgagatgctattaat[C/G]tgtaacgctagccccaaccctgtg
- ASB in cell types
- VCaP (prostate carcinoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | -0.46 | 0.94 | 2.36 | |||
| A549 (lung carcinoma) | 0.76 | 0.10 | 2.07 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol change with statins, triglycerides, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Stomach, Testis