rs10947479 chr6:34163599 A>G
- Sequence
ccagtgagaggctgaaggtgaccc[A/G]ctttgtaaccatgaagaactctcc
- ASB in cell types
- SK-N-SH (neuroblastoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.18 | 1.09 | 1.63 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), ldl cholesterol, primary rhegmatogenous retinal detachment, prop taste detection threshold, refractive error, total cholesterol